Quickbrowse: Go to a tool by selecting the abbreviated tool name from the menu.
Contents: Click a blue triangle to expand or collapse a list
The tools in this section get things, like files or sequences - e.g., from
the Web.
To use a script, cut and paste the code from the light green or blue box into a
terminal window, change the bold, red text as needed, and hit Enter.
See More Information for notes on using these tools.
Gets a sequence with a given id from a given database. (The database
must be one of: swiss, genbank, genpept, embl, refseq.) The format of the
fetched sequence (fasta by default) can be embl, fasta, gcg, genbank, swiss,
or a whole bunch of other formats: see
The Bioperl SeqIO HOWTO
for details.
This script requires Bioperl to be installed (on whichever machine the
script runs on). Many biology computers will have it installed. If the script
breaks because it "can't locate Bio/Perl.pm", you can download Bioperl from
bioperl.org.
Example: Get the ROA1_HUMAN sequence from Swiss-Prot in FASTA format, and
put it in seq.fasta by running the above script.
Output file (seq.fasta) |
Screen Output |
>AI129902; qc41b07.x1 Soares_pregnant_uterus_NbHPU Homo sapiens cDNA [etc.]
CTCCGCGCCAACTCCCCCCACCCCCCCCCCACACCCC
|
Wrote embl sequence AI129902 in fasta format
|
Given an http or ftp address, get a file and store it in a given filename.
This assumes you have an Internet connection, the file exists, etc.
If something breaks, it should print an error message.
Example: Run the above script to download the current GenBank release number
to a file GB.txt. The resulting file will have in it one line, giving the
release number (as of this writing, 151).
Example 2: Download the NCBI home page by setting $web_file to
"http://ncbi.nih.gov" and $store to "ncbi.html".
As always, when in doubt, check your output files after each step!
Scripts that need to fetch information from the Web will of course
break if your Internet connection isn't working.
Scriptome tools are in blue or green boxes. Cut and paste the text of the
tool into a terminal window. Then edit the line as needed.
Things that will often need to be edited are highlighted in
red. Input and output filenames will almost always need to be changed.
All scripts that work on tabular data assume the data is tab-separated.
Use a Change script to change, e.g., comma-separated data
to tab-separated before using these scripts.
When working with tabular data, remember that the first column is called
column 0, the second column is column 1, etc. The last column can
also be referred to as column -1, second-to-last column is -2, etc.
- something_related
-
Do something related to merging that isn't on this page.
